™ Of-War ™

Hola! ¿Estas registrado?
Si no lo estas, ¿que esperas?
Se parte del foro de ™️ Of-War ™️!!
™ Of-War ™

Bienvenidos a nuestra comunidad de juegos online » S4 League « Saludos (:

Últimos temas

» Armas del S4 League en 3D
Mar Mar 08, 2011 12:19 am por Drakonerd

» Presentación de Drakonerd
Sáb Feb 26, 2011 5:23 am por Drakonerd

»  ¿Por que hay gente que los llama POWER RANGERS?
Vie Feb 25, 2011 11:10 pm por shakes351

Vie Feb 25, 2011 11:09 pm por shakes351

» Hacer un video de nosotros del S4 League.
Vie Feb 25, 2011 11:08 pm por shakes351

» fanart......
Vie Feb 25, 2011 11:07 pm por shakes351

» Cual Server de estos es mejor para jugar?
Dom Ene 30, 2011 8:06 pm por shakes351

» !!Chiste wiii !!
Dom Ene 30, 2011 7:49 pm por shakes351

» Supeer Aburiido
Dom Ene 30, 2011 7:30 pm por shakes351

Haora en facebook



Mejores posteadores

shakes351 (117)
Misa (56)
kizuna (39)
Cliqeame (36)
*Spit-Fire* (28)
Shinigami (21)
cv-Pro[s]._. (19)
VictoriaLove (11)
HarLeKing (9)
dragh (7)

Noviembre 2018


Calendario Calendario

    Mi primer y unico Video


    Mensajes : 36
    Puntos : 53
    Reputación : 1
    Fecha de inscripción : 10/01/2011
    Edad : 29
    Localización : S4 League - Tunel :D

    Mi primer y unico Video

    Mensaje por Cliqeame el Jue Ene 13, 2011 3:57 pm

    Bueeeeeeeeeeee csm mi videito de Sniper Razz espero les guste

    Última edición por Cliqeame el Jue Ene 13, 2011 4:16 pm, editado 1 vez



    Mensajes : 21
    Puntos : 47
    Reputación : 2
    Fecha de inscripción : 13/01/2011
    Edad : 21

    Re: Mi primer y unico Video

    Mensaje por Shinigami el Jue Ene 13, 2011 4:09 pm

    Wenisimo Video , Enseñamee! Pro:D

    Mensajes : 36
    Puntos : 53
    Reputación : 1
    Fecha de inscripción : 10/01/2011
    Edad : 29
    Localización : S4 League - Tunel :D

    Re: Mi primer y unico Video

    Mensaje por Cliqeame el Jue Ene 13, 2011 4:17 pm

    tan rapido lo viste wn ? XDD

    Mensajes : 21
    Puntos : 47
    Reputación : 2
    Fecha de inscripción : 13/01/2011
    Edad : 21

    Re: Mi primer y unico Video

    Mensaje por Shinigami el Jue Ene 13, 2011 6:14 pm

    Se , porke con tus Fails de suvir el video , se vei el link de YT , ii aproveche para mirarlo xD

    Mensajes : 36
    Puntos : 53
    Reputación : 1
    Fecha de inscripción : 10/01/2011
    Edad : 29
    Localización : S4 League - Tunel :D

    Re: Mi primer y unico Video

    Mensaje por Cliqeame el Jue Ene 13, 2011 9:15 pm

    Shinigami escribió:Se , porke con tus Fails de suvir el video , se vei el link de YT , ii aproveche para mirarlo xD
    Malooo T.T affraid

    Mensajes : 56
    Puntos : 60
    Reputación : 0
    Fecha de inscripción : 14/01/2011
    Localización : Arcade

    Re: Mi primer y unico Video

    Mensaje por Misa el Vie Ene 14, 2011 6:46 pm

    O.O WTF!!! que aim!! te odio!! que envidia xD
    menos mal que te tengo de amigo y no de enemigo e.e
    Por cierto, me encanto el tema!!! >.< decime el nombre!!

    Mensajes : 9
    Puntos : 11
    Reputación : 0
    Fecha de inscripción : 14/01/2011
    Edad : 24
    Localización : S4 League - Station 2 Striker

    Re: Mi primer y unico Video

    Mensaje por HarLeKing el Vie Ene 14, 2011 8:14 pm

    Bueno ese AIM Tienes que enseñarme bueno pero la forma mas facil es en ST2 Con una rail gun o con una HG :p

    Mensajes : 36
    Puntos : 53
    Reputación : 1
    Fecha de inscripción : 10/01/2011
    Edad : 29
    Localización : S4 League - Tunel :D

    Re: Mi primer y unico Video

    Mensaje por Cliqeame el Sáb Ene 15, 2011 8:14 am

    Misa escribió:O.O WTF!!! que aim!! te odio!! que envidia xD
    menos mal que te tengo de amigo y no de enemigo e.e
    Por cierto, me encanto el tema!!! >.< decime el nombre!!

    HarLeKing escribió:Bueno ese AIM Tienes que enseñarme bueno pero la forma mas facil es en ST2 Con una rail gun o con una HG :p

    ahahaha solo tengo ese AIM con Rail Gun y en Tunel ... el resto de los mapas soi un asco de Sniper XD
    y para aprender a railar es facil .... pones una sentry, te ganas a una distancia mui lejana y practicas dandole a la sentry ( pero disparando cuando aces una evacion ) asi practique yo, y ademas deves de tener conocimientos de Atake y de carroña, para saver o pensar qe camino tomara el oponente y darle un railaso cuando menos se lo espere .... o tambien otro modo de aprender a railar es acerle focus al fumby Razz

    eso =)



    Mensajes : 56
    Puntos : 60
    Reputación : 0
    Fecha de inscripción : 14/01/2011
    Localización : Arcade

    Re: Mi primer y unico Video

    Mensaje por Misa el Sáb Ene 15, 2011 11:19 am

    Lo tendré en cuenta, creo que voy a empezar a practicar así.
    Nota : Todavia no me dijiste el nombre del tema xD

    Mensajes : 36
    Puntos : 53
    Reputación : 1
    Fecha de inscripción : 10/01/2011
    Edad : 29
    Localización : S4 League - Tunel :D

    Re: Mi primer y unico Video

    Mensaje por Cliqeame el Sáb Ene 15, 2011 9:05 pm

    Misa escribió:Lo tendré en cuenta, creo que voy a empezar a practicar así.
    Nota : Todavia no me dijiste el nombre del tema xD
    sera xq no me acuerdo ? D:

    Mensajes : 117
    Puntos : 197
    Reputación : 0
    Fecha de inscripción : 19/01/2011
    Edad : 34
    Localización : Station Vr. 2

    Re: Mi primer y unico Video

    Mensaje por shakes351 el Miér Ene 19, 2011 4:15 pm

    ugggggguuuuuuuaaaauuuuuuu m,en me enseñas o dios deverias ser el master de el s4 league asi suyperas hasta los k ya son s4 xD ta weno

    Mensajes : 56
    Puntos : 60
    Reputación : 0
    Fecha de inscripción : 14/01/2011
    Localización : Arcade

    Re: Mi primer y unico Video

    Mensaje por Misa el Jue Ene 20, 2011 6:25 am

    >.> recuerdalo!

    Mensajes : 117
    Puntos : 197
    Reputación : 0
    Fecha de inscripción : 19/01/2011
    Edad : 34
    Localización : Station Vr. 2

    Re: Mi primer y unico Video

    Mensaje por shakes351 el Jue Ene 20, 2011 10:19 am


    Contenido patrocinado

    Re: Mi primer y unico Video

    Mensaje por Contenido patrocinado

      Fecha y hora actual: Lun Nov 12, 2018 6:21 pm